FC876174

Overview
NameFC876174
Unique NameFC876174
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length707
Libraries
Library NameType
DevOvary1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9339 contig Ccv1_Contig9339:1..707. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of FC876174 vs. ExPASy Swiss-Prot
Match: EFTU_BIFLO (Elongation factor Tu OS=Bifidobacterium longum GN=tuf PE=3 SV=1)

HSP 1 Score: 100.523 bits (249), Expect = 9.153e-21
Identity = 67/194 (34.54%), Postives = 99/194 (51.03%), Query Frame = 3
Query:   90 KEKTHINIVVIGHVDSGKSTTTGHLIYKLGGIDKRVIERFEKEVAEMNKRSFKYAWVLDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVKEVSSYLKKVGYNPEKVPFVPTSGF 671
            + K H+NI  IGHVD GK+T T         I K + E F     E +         +D    E  RGITI+IA  +++T K +   +D PGH DF+KNMITG +Q D A+L++ +T G          QTREH LLA  +GV +++   NK D       +   + + +EV   L + G++ +  P + TS +
Sbjct:    8 RTKPHVNIGTIGHVDHGKTTLTA-------AISKVLHEEFPDVNPEYDFNQ------IDSAPEEAARGITINIAHIEYQTEKRHYAHVDCPGHADFVKNMITGAAQMDGAILVVAATDGPM-------AQTREHVLLARQVGVPKILVALNKCDMVD---DEELIELVEEEVRDLLDENGFDRD-CPVIHTSAY 177          
BLAST of FC876174 vs. ExPASy Swiss-Prot
Match: EFTU_BIFLI (Elongation factor Tu OS=Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / NCTC 11817 / S12) GN=tuf PE=3 SV=1)

HSP 1 Score: 100.523 bits (249), Expect = 9.153e-21
Identity = 67/194 (34.54%), Postives = 99/194 (51.03%), Query Frame = 3
Query:   90 KEKTHINIVVIGHVDSGKSTTTGHLIYKLGGIDKRVIERFEKEVAEMNKRSFKYAWVLDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVKEVSSYLKKVGYNPEKVPFVPTSGF 671
            + K H+NI  IGHVD GK+T T         I K + E F     E +         +D    E  RGITI+IA  +++T K +   +D PGH DF+KNMITG +Q D A+L++ +T G          QTREH LLA  +GV +++   NK D       +   + + +EV   L + G++ +  P + TS +
Sbjct:    8 RTKPHVNIGTIGHVDHGKTTLTA-------AISKVLHEEFPDVNPEYDFNQ------IDSAPEEAARGITINIAHIEYQTEKRHYAHVDCPGHADFVKNMITGAAQMDGAILVVAATDGPM-------AQTREHVLLARQVGVPKILVALNKCDMVD---DEELIELVEEEVRDLLDENGFDRD-CPVIHTSAY 177          
BLAST of FC876174 vs. ExPASy Swiss-Prot
Match: EFTU_BIFLD (Elongation factor Tu OS=Bifidobacterium longum (strain DJO10A) GN=tuf PE=3 SV=1)

HSP 1 Score: 100.523 bits (249), Expect = 9.153e-21
Identity = 67/194 (34.54%), Postives = 99/194 (51.03%), Query Frame = 3
Query:   90 KEKTHINIVVIGHVDSGKSTTTGHLIYKLGGIDKRVIERFEKEVAEMNKRSFKYAWVLDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVKEVSSYLKKVGYNPEKVPFVPTSGF 671
            + K H+NI  IGHVD GK+T T         I K + E F     E +         +D    E  RGITI+IA  +++T K +   +D PGH DF+KNMITG +Q D A+L++ +T G          QTREH LLA  +GV +++   NK D       +   + + +EV   L + G++ +  P + TS +
Sbjct:    8 RTKPHVNIGTIGHVDHGKTTLTA-------AISKVLHEEFPDVNPEYDFNQ------IDSAPEEAARGITINIAHIEYQTEKRHYAHVDCPGHADFVKNMITGAAQMDGAILVVAATDGPM-------AQTREHVLLARQVGVPKILVALNKCDMVD---DEELIELVEEEVRDLLDENGFDRD-CPVIHTSAY 177          
BLAST of FC876174 vs. ExPASy Swiss-Prot
Match: EFTU_THEMA (Elongation factor Tu OS=Thermotoga maritima GN=tuf PE=3 SV=2)

HSP 1 Score: 100.138 bits (248), Expect = 1.195e-20
Identity = 67/195 (34.36%), Postives = 94/195 (48.21%), Query Frame = 3
Query:   90 KEKTHINIVVIGHVDSGKSTTTGHLIYKLGGIDKRVIERFEKEVAEMNKRSFKYAWVLDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVKEVSSYLKKVGYNPEKVPFVPTSGFE 674
            + K H+N+  IGH+D GKST T  +                K ++      +     +DK   E+ RGITI+I   ++ET K +   ID PGH D+IKNMITG +Q D A+L++ +T G          QTREH LLA  + V  MI   NK D           D +  EV   L + GY  ++VP +  S  +
Sbjct:    8 RTKPHVNVGTIGHIDHGKSTLTAAI---------------TKYLSLKGLAQYIPYDQIDKAPEEKARGITINITHVEYETEKRHYAHIDCPGHADYIKNMITGAAQMDGAILVVAATDGPMP-------QTREHVLLARQVEVPYMIVFINKTDMVD---DPELIDLVEMEVRDLLSQYGYPGDEVPVIRGSALK 177          
BLAST of FC876174 vs. ExPASy Swiss-Prot
Match: EFTU_TAXOC (Elongation factor Tu OS=Taxeobacter ocellatus GN=tuf PE=3 SV=1)

HSP 1 Score: 100.138 bits (248), Expect = 1.195e-20
Identity = 67/197 (34.01%), Postives = 96/197 (48.73%), Query Frame = 3
Query:   90 KEKTHINIVVIGHVDSGKSTTTGHLIYKLGGIDKRVIERFEKEVAEMNKRSFKYAWVLDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVKEVSSYLKKVGYNPEKVPFVPTSGFEGD 680
            + K H+NI  IGHVD GK+T T  +   L            K +A   KR F     +D    E+ERGITI+ A  ++ T   +   +D PGH D++KNM+TG +Q D A+L++ +T G          QTREH LLA  +GV Q++   NK+D           +  ++E+ S+    G N   V      G  GD
Sbjct:    8 RSKPHVNIGTIGHVDHGKTTLTAAITTVLAN----------KGLAA--KRDFSS---IDNAPEEKERGITINTAHVEYSTANRHYAHVDCPGHADYVKNMVTGAAQMDGAILVVAATDGPMP-------QTREHILLARQVGVPQLVVFMNKVDMVDDPELLELVEMEIRELLSFYDFDGDNIPVVQGSALGGLNGD 182          
BLAST of FC876174 vs. ExPASy Swiss-Prot
Match: EFTU_SALRD (Elongation factor Tu OS=Salinibacter ruber (strain DSM 13855) GN=tuf1 PE=3 SV=1)

HSP 1 Score: 100.138 bits (248), Expect = 1.195e-20
Identity = 69/196 (35.20%), Postives = 101/196 (51.53%), Query Frame = 3
Query:   90 KEKTHINIVVIGHVDSGKSTTTGHLIYKLGGIDKRVIERFEKEVAEMNKRSFKYAWVLDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVK-EVSSYLKKVGYNPEKVPFVPTSGFE 674
            +EK H+N+  IGHVD GK+T T         I K + ER    V    +++F+    +D    ERERGITI  +  ++ET   +   +D PGH D++KNM+TG +Q D A+L++ S  G          QTREH LLA  +GV  ++   NK D        A   E+V+ EV   L +  +  ++VP V  S  +
Sbjct:    8 REKPHVNVGTIGHVDHGKTTLTA-------AITKVLAER----VGGAAEQTFE---AIDNAPEERERGITIATSHVEYETENRHYAHVDCPGHADYVKNMVTGAAQMDGAILVVGSDDGPMP-------QTREHILLARQVGVPYLVVFMNKTDLV----DDAELLELVEMEVRELLTEYEFPGDEVPVVRGSALQ 178          
BLAST of FC876174 vs. ExPASy Swiss-Prot
Match: EFTU_RICSI (Elongation factor Tu OS=Rickettsia sibirica GN=tuf PE=3 SV=1)

HSP 1 Score: 100.138 bits (248), Expect = 1.195e-20
Identity = 63/198 (31.82%), Postives = 95/198 (47.98%), Query Frame = 3
Query:   90 KEKTHINIVVIGHVDSGKSTTTGHL---IYKLGGIDKRVIERFEKEVAEMNKRSFKYAWVLDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVKEVSSYLKKVGYNPEKVPFVPTSGFE 674
            + K H+NI  IGHVD GK++ T  +   + K GG      ++                  +D    E+ERGITI  A  ++ET   +   +D PGH D++KNMITG +Q D A+L++ +  G          QTREH LLA  +GV  M+   NK+D           + +  EV   L K G+  +++P +  S  +
Sbjct:    8 RTKPHVNIGTIGHVDHGKTSLTAAITIVLAKTGGAQATAYDQ------------------IDAAPEEKERGITISTAHVEYETKNRHYAHVDCPGHADYVKNMITGAAQMDGAILVVSAADGPMP-------QTREHILLAKQVGVPAMVVFLNKIDMVD---DPDLLELVEMEVRELLSKYGFPGDEIPIIKGSALQ 177          
BLAST of FC876174 vs. ExPASy Swiss-Prot
Match: EFTU_RICRS (Elongation factor Tu OS=Rickettsia rickettsii (strain Sheila Smith) GN=tuf PE=3 SV=1)

HSP 1 Score: 100.138 bits (248), Expect = 1.195e-20
Identity = 63/198 (31.82%), Postives = 95/198 (47.98%), Query Frame = 3
Query:   90 KEKTHINIVVIGHVDSGKSTTTGHL---IYKLGGIDKRVIERFEKEVAEMNKRSFKYAWVLDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVKEVSSYLKKVGYNPEKVPFVPTSGFE 674
            + K H+NI  IGHVD GK++ T  +   + K GG      ++                  +D    E+ERGITI  A  ++ET   +   +D PGH D++KNMITG +Q D A+L++ +  G          QTREH LLA  +GV  M+   NK+D           + +  EV   L K G+  +++P +  S  +
Sbjct:    8 RTKPHVNIGTIGHVDHGKTSLTAAITIVLAKTGGAQATAYDQ------------------IDAAPEEKERGITISTAHVEYETKNRHYAHVDCPGHADYVKNMITGAAQMDGAILVVSAADGPMP-------QTREHILLAKQVGVPAMVVFLNKIDMVD---DPDLLELVEMEVRELLSKYGFPGDEIPIIKGSALQ 177          
BLAST of FC876174 vs. ExPASy Swiss-Prot
Match: EFTU_RICRO (Elongation factor Tu OS=Rickettsia rickettsii (strain Iowa) GN=tuf PE=3 SV=1)

HSP 1 Score: 100.138 bits (248), Expect = 1.195e-20
Identity = 63/198 (31.82%), Postives = 95/198 (47.98%), Query Frame = 3
Query:   90 KEKTHINIVVIGHVDSGKSTTTGHL---IYKLGGIDKRVIERFEKEVAEMNKRSFKYAWVLDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVKEVSSYLKKVGYNPEKVPFVPTSGFE 674
            + K H+NI  IGHVD GK++ T  +   + K GG      ++                  +D    E+ERGITI  A  ++ET   +   +D PGH D++KNMITG +Q D A+L++ +  G          QTREH LLA  +GV  M+   NK+D           + +  EV   L K G+  +++P +  S  +
Sbjct:    8 RTKPHVNIGTIGHVDHGKTSLTAAITIVLAKTGGAQATAYDQ------------------IDAAPEEKERGITISTAHVEYETKNRHYAHVDCPGHADYVKNMITGAAQMDGAILVVSAADGPMP-------QTREHILLAKQVGVPAMVVFLNKIDMVD---DPDLLELVEMEVRELLSKYGFPGDEIPIIKGSALQ 177          
BLAST of FC876174 vs. ExPASy Swiss-Prot
Match: EFTU_RICRI (Elongation factor Tu OS=Rickettsia rickettsii GN=tuf PE=3 SV=1)

HSP 1 Score: 100.138 bits (248), Expect = 1.195e-20
Identity = 63/198 (31.82%), Postives = 95/198 (47.98%), Query Frame = 3
Query:   90 KEKTHINIVVIGHVDSGKSTTTGHL---IYKLGGIDKRVIERFEKEVAEMNKRSFKYAWVLDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVKEVSSYLKKVGYNPEKVPFVPTSGFE 674
            + K H+NI  IGHVD GK++ T  +   + K GG      ++                  +D    E+ERGITI  A  ++ET   +   +D PGH D++KNMITG +Q D A+L++ +  G          QTREH LLA  +GV  M+   NK+D           + +  EV   L K G+  +++P +  S  +
Sbjct:    8 RTKPHVNIGTIGHVDHGKTSLTAAITIVLAKTGGAQATAYDQ------------------IDAAPEEKERGITISTAHVEYETKNRHYAHVDCPGHADYVKNMITGAAQMDGAILVVSAADGPMP-------QTREHILLAKQVGVPAMVVFLNKIDMVD---DPDLLELVEMEVRELLSKYGFPGDEIPIIKGSALQ 177          
The following BLAST results are available for this feature:
BLAST of FC876174 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 500
Match NameE-valueIdentityDescription
EFTU_BIFLO9.153e-2134.54Elongation factor Tu OS=Bifidobacterium longum GN=... [more]
EFTU_BIFLI9.153e-2134.54Elongation factor Tu OS=Bifidobacterium longum sub... [more]
EFTU_BIFLD9.153e-2134.54Elongation factor Tu OS=Bifidobacterium longum (st... [more]
EFTU_THEMA1.195e-2034.36Elongation factor Tu OS=Thermotoga maritima GN=tuf... [more]
EFTU_TAXOC1.195e-2034.01Elongation factor Tu OS=Taxeobacter ocellatus GN=t... [more]
EFTU_SALRD1.195e-2035.20Elongation factor Tu OS=Salinibacter ruber (strain... [more]
EFTU_RICSI1.195e-2031.82Elongation factor Tu OS=Rickettsia sibirica GN=tuf... [more]
EFTU_RICRS1.195e-2031.82Elongation factor Tu OS=Rickettsia rickettsii (str... [more]
EFTU_RICRO1.195e-2031.82Elongation factor Tu OS=Rickettsia rickettsii (str... [more]
EFTU_RICRI1.195e-2031.82Elongation factor Tu OS=Rickettsia rickettsii GN=t... [more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionC32001B11EF DevOvary1 Citrus clementina cDNA clone C32001B11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC876174 ID=FC876174|Name=FC876174|organism=Citrus clementina|type=EST|length=707bp
GACTCTTTGCCCTCCCTCTTTTCTTGCTTGCTCTGCGGCTAGGTTTCAAT
TGTCTCTTCGAAGTTTCAGTTAATTTAACAGCCATGGGTAAGGAGAAGAC
TCACATCAACATTGTGGTGATTGGCCATGTCGACTCTGGAAAGTCGACCA
CCACCGGACACTTGATCTACAAGCTTGGTGGTATTGACAAGCGTGTGATC
GAGAGGTTCGAGAAGGAAGTTGCTGAGATGAACAAGAGGTCATTCAAGTA
CGCCTGGGTGCTCGACAAGCTCAAGGCTGAGCGTGAACGTGGTATTACCA
TTGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTC
ATTGATGCTCCCGGACATCGTGACTTTATCAAGAACATGATTACCGGTAC
CTCACAGGCTGACTGTGCCGTCCTTATCATTGACTCCACCACCGGTGGTT
TTGAAGCTGGTATCTCCAAGGATGGTCAGACTCGTGAGCATGCTTTGCTT
GCTTTCACCCTTGGTGTGAAGCAGATGATTTGCTGCTGTAACAAGATGGA
CGCCACCACCCCCAAGTACTCAAAGGCTAGGTACGATGAAATTGTGAAGG
AGGTCTCTTCCTACCTGAAGAAGGTTGGATACAACCCCGAGAAAGTCCCA
TTCGTGCCCACCTCTGGTTTCGAGGGTGACAACATGATTGAGAGGTCTAC
CAACCTT
back to top