m880_s3, m880_s3 (genetic_marker) Citrus reticulata

Marker Overview
Namem880_s3
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesCitrus reticulata
Publication[view all]
ContactFrederick Gmitter
Contact
NameDetails
Frederick Gmitter
First name:Frederick
Last name:Gmitter
Title:Researcher
Institution:University of Florida
Address:Citrus Research and Education Center, University of Florida, Lake Alfred, FL 33850, USA
Country:USA
Email:fgmitter@ufl.edu
Last update:Nov 2018
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
m880_s3m880_s3Citrus reticulatamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Fortune/Murcott-Murcott-F1-1991MUR3.2N/A10.1m880_s3View
2Citrus-Fortune/Murcott-Murcott-F1-2017MUR3.2N/A10.1m880_s3View
Sequence
>m880_s3 ID=m880_s3|Name=m880_s3|organism=Citrus reticulata|type=genetic_marker|length=242bp
ATTAGTAGGTGTCAGTACATGAACAGGAGAGGAGTTCTATCCTGCATAGA
CATGAAACATGCAAATATATGAAATAGTTAATTGGAACCTCCTATGTTTA
GCGAAACCAGTGCATGGATTTRTCTCCTCTTGGTTCTATCCTCGATATAC
AGTGCTATCTTAGGGAGAAAATACCTTGTTGACTCTTTTAATGGGAAAAA
TAAGAAATATATTCAGGTTTGTGAAAATTATTTTTGATTTTG