m1316_s, m1316_s (genetic_marker) Citrus reticulata

Marker Overview
Namem1316_s
dbSNP IDN/A
TypeSNP
SNP AllelesC/A
SpeciesCitrus reticulata
Publication[view all]
ContactFrederick Gmitter
Contact
NameDetails
Frederick Gmitter
First name:Frederick
Last name:Gmitter
Title:Researcher
Institution:University of Florida
Address:Citrus Research and Education Center, University of Florida, Lake Alfred, FL 33850, USA
Country:USA
Email:fgmitter@ufl.edu
Last update:Nov 2018
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
m1316_sm1316_sCitrus reticulatamarker_locus


Sequence
>m1316_s ID=m1316_s|Name=m1316_s|organism=Citrus reticulata|type=genetic_marker|length=242bp
GTATGAAACCTTCGGCTACCCACAACTGATATAATTGCCTCGTCGATATC
TCAATACTTGGACGGAAGACACACAAATAGATGCAGCAGACTTTCAAGTG
AAAAGGTAACTCCATCACAGMATAAATTTGTCTCCAAATTGTCGGAATCG
CTTCGCCTTGAACATAATTTTCTAATGGCATACTTCCATAGTGTAGGATG
AAAAATTGCCACGATTCATGCTTTAATCTGATCATCTGTCCT