Mdh, Mdh (genetic_marker) Citrus spp.

Marker Overview
NameMdh
Genbank IDDQ901430
TypeSSR
SpeciesCitrus spp.
Primer 1Mdh.Forward Primer: ATGGCCGCTACATCAGCTAC
Primer 2Mdh.Reverse Primer: TGCAACCCCCTTTTCAATAC
Publication[view all]
ContactPatrick Ollitrault
Contact
NameDetails
Patrick Ollitrault
First name:Patrick
Last name:Ollitrault
Title:Researcher
Institution:CIRAD
Address:Unite de Recherche Multiplication Vegetative, Centre de Cooperation Internationale en Recherche Agronomique pour le Developpement (CIRAD), Montpellier 34398, France
Country:France
Email:patrick.ollitrault@cirad.fr
Phone:+33(0)467615971
Fax:+33(0)467615666
Last update:Jun 2020
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerMdh.Forward PrimerCitrus spp.primer
Reverse PrimerMdh.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MdhMdhCitrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Poncirus-FlyingDragon/FlyingDragon-RIL-2003Pp1N/A26.8MdhView