|
Marker Overview
Name | Mdh |
Genbank ID | DQ901430 |
Type | SSR |
Species | Citrus spp. |
Primer 1 | Mdh.Forward Primer: ATGGCCGCTACATCAGCTAC |
Primer 2 | Mdh.Reverse Primer: TGCAACCCCCTTTTCAATAC |
Publication | [view all] |
Contact | Patrick Ollitrault
|
Publications
Year | Publication |
2013 | Garcia-Lor A, Curk F, Snoussi-Trifa H, Morillon R, Ancillo G, Luro F, Navarro L, Ollitrault P. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species. Annals of botany. 2013 Jan; 111(1):1-19. |
2003 | Ruiz C, Asins M. Comparison between Poncirus and Citrus genetic linkage maps. Theoretical and applied genetics. 2003 Mar; 106(5):826-836. |
|