TAA1, TAA1 (genetic_marker) Citrus spp.

Marker Overview
NameTAA1
Genbank IDN/A
TypeSSR
SpeciesCitrus spp.
Repeat MotifTAA
Primer 1TAA1.Forward Primer: GACAACATCAACAACAGCAAGAGC
Primer 2TAA1.Reverse Primer: AAGAAGAAGAGCCCCCATTAGC
Publication[view all]
ContactWen-Wu Guo
A. Nematollahi
Behrouz Golein
X.X. Deng
MJ Asins
M Thomas
Qi-bin Hong
Contact
NameDetails
Wen-Wu Guo
First name:Wen-Wu
Last name:Guo
Title:Researcher
Institution:Huazhong Agricultural University
Address:Key Laboratory of Horticultural Plant Biology (Ministry of Education), Huazhong Agricultural University, Wuhan 430070, China
Country:China
Email:guoww@mail.hzau.edu.cn
Phone:+86 27 8728 1543
Fax:+86 27 8728 0016
A. Nematollahi
First name:A.
Last name:Nematollahi
Title:Researcher
Institution:College of Abouraihan
Address:Department of Horticulture, College of Abouraihan, University of Tehran, Tehran, Iran
Country:Iran
Behrouz Golein
First name:Behrouz
Last name:Golein
Title:Researcher
Institution:Iran Citrus Research Institute
Address:Department of Plant Breeding and Improvement, Iran Citrus Research Institute, Ramsar, Islamic Republic of Iran
Country:Iran
Email:bgoleincitrus@yahhoo.com
Phone:+98 9113945261
Fax:+98 1925223282
X.X. Deng
First name:X.X.
Last name:Deng
Title:Researcher
Institution:Huazhong Agricultural University
Address:National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, P.R. China
Country:China
Email:dxxwwlj@public.wh.hb.cn
MJ Asins
First name:MJ
Last name:Asins
Title:Researcher
Institution:IVIA
Address:Instituto Valenciano de Investigaciones Agrarias (IVIA), Apartado Oficial, 46113 Moncada (Valencia), Spain
Country:Spain
Email:mjasins@ivia.es
Fax:+34-961390240
M Thomas
First name:M
Last name:Thomas
Institution:CSIRO
Address:CSIRO, Division of Horticulture, GPO Box 350, Adelaide, S.A 5001, Australia
Qi-bin Hong
First name:Qi-Bin
Last name:Hong
Title:Researcher
Institution:Chinese Academy of Agricultural Sciences/Southwest University
Address:Citrus Research Institute, Chinese Academy of Agricultural Sciences/Southwest University, National Citrus Engineering Research Center, Chongqing, P.R. China
Country:China
Email:hongqb@sina.com
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerTAA1.Forward PrimerCitrus spp.primer
Reverse PrimerTAA1.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TAA1TAA1Citrus spp.marker_locus
TAA1, 175TAA1, 175Citrus spp.marker_locus