|
Marker Overview
Name | MGB |
Genbank ID | N/A |
Type | gene marker |
Species | Citrus spp. |
Primer 1 | MGB.Forward Primer: CGGCTGGCTTCTCTGTTCTT |
Primer 2 | MGB.Reverse Primer: GCGAACACGAAAACGTGACA |
Publication | [view all] |
Contact | Franca Locatelli
|
Publications
Year | Publication |
2012 | Caruso P, Baldoni E, Mattana M, Pietro Paolo D, Genga A, Coraggio I, Russo G, Picchi V, Reforgiato Recupero G, Locatelli F. Ectopic expression of a rice transcription factor, Mybleu, enhances tolerance of transgenic plants of Carrizo citrange to low oxygen stress. Plant cell, tissue, and organ culture. 2012; 109(2):327-339. |
|