|
|
Marker Overview
| Name | MGB |
|---|
| Genbank ID | N/A |
|---|
| Type | gene marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | MGB.Forward Primer: CGGCTGGCTTCTCTGTTCTT |
|---|
| Primer 2 | MGB.Reverse Primer: GCGAACACGAAAACGTGACA |
|---|
| Publication | [view all] |
|---|
| Contact | Franca Locatelli
|
|---|
Publications
| Year | Publication |
|---|
| 2012 | Caruso P, Baldoni E, Mattana M, Pietro Paolo D, Genga A, Coraggio I, Russo G, Picchi V, Reforgiato Recupero G, Locatelli F. Ectopic expression of a rice transcription factor, Mybleu, enhances tolerance of transgenic plants of Carrizo citrange to low oxygen stress. Plant cell, tissue, and organ culture. 2012; 109(2):327-339. |
|
