Mybleu, Mybleu (genetic_marker) Citrus spp.

Marker Overview
NameMybleu
Genbank IDN/A
Typegene marker
SpeciesCitrus spp.
Primer 1Mybleu.Forward Primer: ACAAGAAGGGGCTCAAGAAGG
Primer 2Mybleu.Reverse Primer: GTATAAGCAGCATCTAAGGCC
Publication[view all]
ContactFranca Locatelli
Contact
NameDetails
Franca Locatelli
First name:Franca
Last name:Locatelli
Title:Researcher
Institution:Istituto di Biologia e Biotecnologia Agraria
Address:Istituto di Biologia e Biotecnologia Agraria, C.N.R., via E. Bassini 15, 20133 Milano, Italy
Country:Italy
Email:locatelli@ibba.cnr.it
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerMybleu.Forward PrimerCitrus spp.primer
Reverse PrimerMybleu.Reverse PrimerCitrus spp.primer