P35S-F, P35S-F (genetic_marker) Citrus spp.

Marker Overview
NameP35S-F
Genbank IDN/A
Typegene marker
SpeciesCitrus spp.
Primer 1P35S-F.Forward Primer: CACTGACGTAAGGGATGACGC
Publication[view all]
ContactFranca Locatelli
Contact
NameDetails
Franca Locatelli
First name:Franca
Last name:Locatelli
Title:Researcher
Institution:Istituto di Biologia e Biotecnologia Agraria
Address:Istituto di Biologia e Biotecnologia Agraria, C.N.R., via E. Bassini 15, 20133 Milano, Italy
Country:Italy
Email:locatelli@ibba.cnr.it
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerP35S-F.Forward PrimerCitrus spp.primer