SCG06053, SCG06053 (genetic_marker) Citrus spp.

Marker Overview
NameSCG06053
Genbank IDN/A
TypeSCAR
SpeciesCitrus spp.
Primer 1SCG06053.Forward Primer: GTGCCTAACCCAGTGTCTGG
Primer 2SCG06053.Reverse Primer: GTGCCTAACCTCACGAACACC
Publication[view all]
ContactCourtney Weber
Contact
NameDetails
Courtney Weber
First name:Courtney
Last name:Weber
Title:Researcher
Institution:University of Florida
Address:Horticultural Sciences Department, University of Florida, Gainesville, FL 32611
Country:USA
Email:caw34@nysaes.cornell.edu
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerSCG06053.Forward PrimerCitrus spp.primer
Reverse PrimerSCG06053.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCG06053SCG06053Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-DPI6-4/Rubidoux-Rubidoux-F1-2003P1N/A0SCG06053View
2Citrus-DPI6.4/Rubidoux-Rubidoux-F1-2003P1N/A0SCG06053View