|
Marker Overview
Name | Al0636 |
Genbank ID | C95540 |
Type | CAPS |
Species | Citrus spp. |
Primer 1 | Al0636.Forward Primer: AAAGATTGGCCACTATTTTGA |
Primer 2 | Al0636.Reverse Primer: GGGCGATTGCTTATTTTGT |
Product Length | 1400 |
Restriction Enzyme | EcoR1 |
Publication | [view all] |
Contact | S. Ohta Mitsuo Omura
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2016 | Carvalho FM, Oliveira JC, Laia ML, Jacob TR, Ferreira RM, Ferro MI, Tezza RI, Zingaretti SM, Silva CF, Ferro JA. Mapping and validation of Xanthomonas citri subsp citri genes regulated by putative plant-inducible promoter box (PIP-box). Genetics and molecular research : GMR. 2016; 15(2). |
|