Bf0011, Bf0011 (genetic_marker) Citrus spp.

Marker Overview
NameBf0011
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
SpeciesCitrus spp.
Primer 1Bf0011.Forward Primer: ATTTGATCCATCTGCCAAGTT
Primer 2Bf0011.Reverse Primer: ATCATTCCAGGGGGTCC
Product Length1900
Restriction EnzymeSI218
Publication[view all]
ContactS. Ohta
Mitsuo Omura
Contact
NameDetails
S. Ohta
First name:S.
Last name:Ohta
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Okitsu Citrus Research Station, NARO Institute of Fruit Tree Science, Shizuoka 424-0292, Japan
Country:Japan
Email:sohta@affrc.go.jp
Mitsuo Omura
First name:Mitsuo
Last name:Omura
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan
Country:Japan
Email:amomura@ipc.shizuoka.ac.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerBf0011.Forward PrimerCitrus spp.primer
Reverse PrimerBf0011.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Bf0011fBf0011fCitrus spp.marker_locus
Bf0011Bf0011Citrus spp.marker_locus