Bf0036, Bf0036 (genetic_marker) Citrus spp.

Marker Overview
NameBf0036
Genbank IDDC885257
TypeCAPS
SpeciesCitrus spp.
Primer 1Bf0036.Forward Primer: TCAAAACCCCAATCTACCGT
Primer 2Bf0036.Reverse Primer: CTGCTTGAGTAACCCCAACTT
Product Length1400
Restriction EnzymeMsp1
Publication[view all]
ContactS. Ohta
Mitsuo Omura
Contact
NameDetails
S. Ohta
First name:S.
Last name:Ohta
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Okitsu Citrus Research Station, NARO Institute of Fruit Tree Science, Shizuoka 424-0292, Japan
Country:Japan
Email:sohta@affrc.go.jp
Mitsuo Omura
First name:Mitsuo
Last name:Omura
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan
Country:Japan
Email:amomura@ipc.shizuoka.ac.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerBf0036.Forward PrimerCitrus spp.primer
Reverse PrimerBf0036.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Bf0036fBf0036fCitrus spp.marker_locus
Bf0036Bf0036Citrus spp.marker_locus