Tf0449, Tf0449 (genetic_marker) Citrus spp.

Marker Overview
NameTf0449
Genbank IDforward primer
TypeCAPS
SpeciesCitrus spp.
Primer 1Tf0449.Forward Primer: TATTCAAATGGCCGAGGAT
Primer 2Tf0449.Reverse Primer: TGGAAACGTCGTATTAGCTCA
Product Length1400
Restriction EnzymeHinf1
Publication[view all]
ContactMitsuo Omura
Contact
NameDetails
Mitsuo Omura
First name:Mitsuo
Last name:Omura
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan
Country:Japan
Email:amomura@ipc.shizuoka.ac.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerTf0449.Forward PrimerCitrus spp.primer
Reverse PrimerTf0449.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Tf0449gTf0449gCitrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Okitsu-46-gou/Kankitsu-Chukanbohon-Nou-5-gou-F2-2014AGI-01N/A0.4Tf0449gView