Sc_8_06

Marker Overview
NameSc_8_06
Genbank IDN/A
TypeSSR
SpeciesCitrus clementina
Repeat Motif(TTAT)5
Primer 1Sc_8_06.Forward: TCAACTTTCCCAGGATGA
Primer 2Sc_8_06.Reverse: GAGGGAAGAGGCTCCTGGTA
Product Length234
Publication[view all]
ContactKwan Song
Contact
NameDetails
Kwan Song
First name:Kwan
Last name:Song
Institution:Jeju National University
Country:Korea
Email:kwansong@jejunu.ac.kr
Last update:Apr 2018
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardSc_8_06.ForwardCitrus clementinaprimer
ReverseSc_8_06.ReverseCitrus clementinaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Sc_8_06Sc_8_06Citrus clementinamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Fina_Sodea/Byungkyool-F1-ByungkyoolB01N/A44.3Sc_8_06View