FC875259

Overview
NameFC875259
Unique NameFC875259
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length679
Libraries
Library NameType
CTVClemen1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig48 contig Ccv1_Contig48:491..1169. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC31402A02EF CTVClemen1 Citrus clementina cDNA clone C31402A02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875259 ID=FC875259|Name=FC875259|organism=Citrus clementina|type=EST|length=679bp
GACTTAAGAGAAACAGAGAGAAACTCTAAAAAGAGAGGGGGGAGAAATGG
GACGCTTTTCTTGTGAAACTGAATCTTGGGTTGATTCTTCTGAAGCCATA
ATGGAAGAAGAGACCCATGATTTGAATCAAGAACCTCAGTTTTTGACCAT
AACAAGGAGTGGGTTTGATGAAGAAGAAAGTGAAGAGCTTTTAAAGAATG
AAAATAAGAAGAAGAAAAAGAATCAAGTTTTGTTGGAGGGCTACGTGGAG
ACAGATTCAGAGGATGATTTGAAGAGAACAAAGAGCTTGACAGACGAGGA
TCTTGATGAGCTCAAAGGGTGTTTGGATCTTGGGTTTGGTTTCAGCTATG
ACGAGATTCCTGAGCTCTGCAACACTCTGCCTGCACTTGAGCTTTGCTAC
TCAATGAGCCAAAAGTTCATGGATGAGCATCAGAGCCAGAAATCTCCTGA
GAGTCATGGGAATTCTCCTGTGTCGACTGATCCTGTTTCCAGCCCCATTG
CCAATTGGAAGATCTCTAGTCCTGGCGATCATCCGGAAGATGTGAAAGCG
AGACTCAAATATTGGGCACAGGCCGTGGCATGCACTGTTAGGTTGTGCAG
CTGAGAAACAGATTTTAGGAATTTGTGGATTCATCATTTGAGTCAGTAAT
GAATGGACATTTTCTTTTTTGATCATTCA
back to top