FC875274

Overview
NameFC875274
Unique NameFC875274
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length722
Libraries
Library NameType
CTVClemen1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10195 contig Ccv1_Contig10195:1..722. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC31402B06EF CTVClemen1 Citrus clementina cDNA clone C31402B06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875274 ID=FC875274|Name=FC875274|organism=Citrus clementina|type=EST|length=722bp
GATTTCGTTGACTAAAAAAGACTCCTTAAAGGTTAAGGTCAATACCGTCC
TTGGCTCACATGCTCCTCCTCTAACAGTGACACTTGTGCGAGCATTTTCC
TCTAGTGCAAGGGACAATTCCATAATTGAGAACCAGGAACTCAAATTTGA
CCCTCAGGATGCAGTTTATTTCTTGGATGATCTGCCAGCAAGTTTTGATG
TGGGAGAGTACATTTTTGTTTTTAAGATGTTGGTTCAAGATTCTGAGCAA
CAAACTGTTTATGCCACTGGAACTCTAACTCAAGTACCAATTTACGTGAC
GGGACTTATCAAAATCGAAAATGCTAAAATTGCAGTTCTTGATAGTGATC
TTGGGAGTGTGGAAACACAAAAAAAGCTAGATTTAGCTGGAGAAAGTACT
GTGTCAGTATCAGCAAACCACCTGCAGAAGCTGCGTCTGTCATTTCAAAT
GTCCACCCCTCTTGGCAATGCTTTTAAGCCACATCAGGCATTTCTCAGGC
TGAGACATGAGACAAAGGTTGAGCACACCTTTGTAGTCGGGAGCTCTGGG
AAAAAGTTTGAGATAACTCTAGATTTTCTAGGACTTGTTGAGAAGTTCTT
CTATCTCTCAGGTAGATATGACATTCAGCTAACTGTTGGTGATGCTGTCA
TGGAGAACTCTTTATTACGTGATATTGGCTATGTCGAATTAGATCTACCA
GAACCTCCNTGAGATGCATCCC
back to top