FC875279

Overview
NameFC875279
Unique NameFC875279
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length701
Libraries
Library NameType
CTVClemen1cdna_library
Properties
Property NameValue
Genbank descriptionC31402B11EF CTVClemen1 Citrus clementina cDNA clone C31402B11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875279 ID=FC875279|Name=FC875279|organism=Citrus clementina|type=EST|length=701bp
GGTTCCAAGTGTAACACTTTCCCTTCTTCACATCCTTAGTCACAATGAAA
CCCTCTCAACTTTGGAAACCCTATATCGAACCCTCACTCATGCAGTCCAC
ACTCTGCTGTTCAATAGACATTCTACCAAAATCCTCACTCATTTAATCGA
AATTTCCTTAGTCACAATGAAACCCTCTCAACTTTGGAAACCCTATATCG
AACCCTCACTCATGCAGTCCACACTCTGCTGTTCAATAGACATTCTACCA
AAATCCTCACTCATTTAATCGAAATTTCCTGTTTCTCCGTCGTATGCTGT
CATTTCACCATCCTTTTGTCATTGTTTCGCATCGTTCTTTCATCATTTCA
CCATCACCACAAGCAGTTCAAACGCCTTGCAAGGCATATGCTGTTGGTTG
AGCTTTTACTCAAAAGCTGAAGGAGACTACACCCTAACAGATATTTAAAG
CACCAATCCAAGTAAGATCTGCATAGTCATCAGCAGGATTTCTATGTAAG
TTGAAGTAGCTTGTTGATTAGCTCTATAAACATTGCTGAGAAAGATGCTT
TCTATGGTCAAGTGCCCGATAAAGCTTGTCTATATCTACTTTTATTGTGT
AAACAATTCATGTTTATTGATTATAACATTATGATGTTTGCTTATTCATT
TTTTTTAAAATCATTAGAGAAACATATGAACTTGAAAACATTTGTAATAC
T
back to top