FC875280

Overview
NameFC875280
Unique NameFC875280
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length699
Libraries
Library NameType
CTVClemen1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10196 contig Ccv1_Contig10196:1..699. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC31402B12EF CTVClemen1 Citrus clementina cDNA clone C31402B12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875280 ID=FC875280|Name=FC875280|organism=Citrus clementina|type=EST|length=699bp
ATCATTGTCGCTCTTGAGACAAAAGGTGCTTGGTGGGATATTTTCTCATT
TCTTCTAATTCTTATCTTTAAAATAAGATAGTAATCATAATTCTGCTCCT
CATAAGTTACTTTCCTTAAAGAGAAAGAGAGGAAAATAAGATAAAGAAAC
GTATGGGTGTTGTGGATCATTTTTCCGATTACTTTGACTGCTCTCATGGC
AGCTCCAAGCTCAAGAAACGCAGGCAATTGCAGACGGTGGAGGTGAAGGT
TCGGATAGACTGCGAAGGATGCGAGCGCAAGGTAAAGCGGGCCGTAGAGG
GAATGAAAGGAGTGAAGCAGGTGGACGTAGAGCGGAAAGCCAACAAAGTC
ACCGTCGTCGGATACGTGGAGCCGTCGAAGGTCGTGTCACGCATCGCGCA
TCGGACGGGCAAGAAAGCGGAGATCTGGCCCTACGTGCCATACGATGTCG
TGGCCCACCCTTACGCCCCCGGGGTTTATGATAGGAAGGCCCCCGCTGGG
TACGTGCGAAGAGCCGACGACCCACAGGTGTCGCAGATTGCACGTGCGAG
CTCCTTCGAAGTTAGGTACACCACTGCCTTCAGTGATGAGAACACGCAAG
CCTGCGCCATCATGTGATGTCGTGACGACACGTGTGACGTGAAGTCTGTG
CGATGCAGTCAGTATGTTTTTGTTTTTTGTACCTTTCAAGAATTGAGCT
back to top