FC875281

Overview
NameFC875281
Unique NameFC875281
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length681
Libraries
Library NameType
CTVClemen1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC875281_ssr73 microsatellite FC875281_ssr73:73..87. BLAST: Citrus ESTs to Prunus persica proteins V1
FC875281_ssr255 microsatellite FC875281_ssr255:255..266. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig15429 contig Ccv1_Contig15429:2..654. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC31402C01EF CTVClemen1 Citrus clementina cDNA clone C31402C01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875281 ID=FC875281|Name=FC875281|organism=Citrus clementina|type=EST|length=681bp
ACATAAACGAATTTACTCTCTGATAAACACTTTTTAATATATATTTTCAC
TTACCTGCAGTCGTAGCGCTATCTGCTGCTGCTGCTGCTCAAAATGGCTG
AAAGGATCCACCCCGAAACGACACCGCGCAGCGAACAAGAGCCCTCACAT
CCGCCGGCGCCCGCGGCCGCAGGAACCTACGTCATCCAAGTCCCGAAGGA
TCAAATCTACCGAGTTCCGCCCCCCGAGAACGCCGACCGCATCAAGGGCC
TCTCCCGCCGCCGCCGCAAATCCCGCAGCACTACTACCTGCTGCTGCTTC
CGTTTCTGCTGCTGCTCGCTGCTTCTCCTCGTCCTCCTCTTGGCCATCGC
CGCCGGCGTCTTCTACCTCGTCTTCCGTCCCGAATCCCCCAACTACTCCG
TCGACGGCGTCTCCATCGCCGGCCTCAACCTCACCTCGCCGTCCTCCGTC
GTCTCTCCCCGGTTCGACGTCTCCGTCACCGCCGACAATCCGAACGACAA
GATCGGAATCTACTACGAGAGAGGCAGCTCGGTGGAGGTCTCCTACAAGG
ACGTCGCCTTGTGCGACGGCGAATGGCCTCAGTTTTACCAGCCGAAGCAC
AATGTCACGGTTTTCAAGACCTTGCTGAAAGGATCGTCCATCGAGTTGAC
CAGCTCTATGCGCAAAGACCTGGTTGCTGCT
back to top