FC875459

Overview
NameFC875459
Unique NameFC875459
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length312
Libraries
Library NameType
CTVClemen1cdna_library
Alignments
Feature NameTypeLocationAnalysis
FC875459_ssr199 microsatellite FC875459_ssr199:199..213.
FC875459_ssr223 microsatellite FC875459_ssr223:223..243.
Ccv1_Contig243 contig Ccv1_Contig243:103..414. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC31404B10EF CTVClemen1 Citrus clementina cDNA clone C31404B10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875459 ID=FC875459|Name=FC875459|organism=Citrus clementina|type=EST|length=312bp
CTTGTCTGCTGTATCTCTTATTATAACAGTCTGTTTGTAACTCAGTCAAA
TAAGAGCAATAAGCGCAAGAGGGTAACCAAACAAGGTTCAACAACATCTG
GGGGCACACCTTCTAAACGTTCGTCTAAGAGTCAAAGAAAGACTGAAAGT
GCTTCAAAAACGGGGAAGAAGAGTATTCCTGACACTGATGATGAATCTGA
AGAAGAAGAAGAAGGAGAAGACGAAGAAGAAGAAGAAGAAGAAGAGGAAA
AGGAAGAGGAAAAGGAAGAAGAGAAGGAAGAGGAAAAAAAAAAAAAAAAA
AAAAAAAAAAAA
back to top