FC875461

Overview
NameFC875461
Unique NameFC875461
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length707
Libraries
Library NameType
CTVClemen1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Homology
BLAST of FC875461 vs. ExPASy Swiss-Prot
Match: Y5175_ARATH (UPF0706 protein At5g01750 OS=Arabidopsis thaliana GN=At5g01750 PE=1 SV=1)

HSP 1 Score: 191.43 bits (485), Expect = 3.943e-48
Identity = 91/186 (48.92%), Postives = 129/186 (69.35%), Query Frame = 1
Query:  148 IISPEFCAPHLIDLAIVRKVMTISSGNFVVRDIMGNIIFKVKGTLMSIQDRRVLLDASGNPIVTLQQKLMSAHDRWQVFRGESTESCDLIFTAKRSSVFQLKTKLDVFLANNREDV-CDFKVKGGWLDRSCVVYAGDADSSTIVAHVRSFATYSKSFFYMLNSD*WNHMDYWIYLQMHKKHSXQSI 702
            ++ P++CAP+ ID+AIVRK+M+++ GNFV+ D+ GN++FKVK  +  + D+RVLLD SG P+VTL++K++S HDRWQVFRG ST+  DL++T KRSS+ QLKTKLDVFL +N+++  CDF+VKG WL+RSCVVYAG++D+                                I  QMH+KH+ QS+
Sbjct:   27 VVDPKYCAPYPIDMAIVRKMMSLTDGNFVITDVNGNLLFKVKEPVFGLHDKRVLLDGSGTPVVTLREKMVSMHDRWQVFRGGSTDQRDLLYTVKRSSMLQLKTKLDVFLGHNKDEKRCDFRVKGSWLERSCVVYAGESDA--------------------------------IVAQMHRKHTVQSV 180          
The following BLAST results are available for this feature:
BLAST of FC875461 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 1
Match NameE-valueIdentityDescription
Y5175_ARATH3.943e-4848.92UPF0706 protein At5g01750 OS=Arabidopsis thaliana ... [more]
back to top
Properties
Property NameValue
Genbank descriptionC31404B12EF CTVClemen1 Citrus clementina cDNA clone C31404B12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875461 ID=FC875461|Name=FC875461|organism=Citrus clementina|type=EST|length=707bp
GGATAGCATAGGCAAATAACAAGGCTCACGAAACGAGGATTAATTGATCT
CTCTCATAAAAAATTGGGGGGAAAAAAAAACCAAGTCACCTTCATTTCAA
TGGCACAATTAGCTATCTTTCATCCACCACTAATCAATCCTGTTTCAATC
ATCAGCCCTGAGTTTTGTGCTCCTCATCTTATTGATCTTGCAATAGTGAG
AAAGGTTATGACCATAAGCAGTGGCAACTTTGTTGTACGGGACATCATGG
GGAACATCATTTTTAAAGTAAAAGGGACCCTTATGAGCATTCAAGATCGT
CGCGTTTTACTTGATGCATCTGGAAATCCCATTGTCACTCTACAACAAAA
GTTAATGTCAGCTCATGACAGATGGCAAGTTTTCAGGGGAGAAAGTACAG
AGTCCTGTGATCTCATCTTTACTGCTAAAAGATCATCAGTGTTCCAGCTA
AAGACCAAATTAGATGTGTTCTTAGCTAATAACAGAGAGGACGTTTGTGA
TTTTAAAGTCAAAGGAGGTTGGCTGGACAGATCTTGTGTTGTTTATGCTG
GGGACGCAGACTCTTCCACAATTGTTGCCCATGTAAGATCTTTTGCAACT
TACAGCAAATCATTTTTCTATATGTTAAATTCAGACTAATGGAATCATAT
GGATTATTGGATATACTTGCAGATGCATAAGAAGCACTCTNGTCAAAGTA
TCTTGCT
back to top