FC875470

Overview
NameFC875470
Unique NameFC875470
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length731
Libraries
Library NameType
CTVClemen1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10235 contig Ccv1_Contig10235:1..731. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC31404C09EF CTVClemen1 Citrus clementina cDNA clone C31404C09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875470 ID=FC875470|Name=FC875470|organism=Citrus clementina|type=EST|length=731bp
ATTCCCTTCATTTTGGTATCGTCTGCTCCCCGCGGACGCCAAAGCTCTTC
CCTCATCATCCAACCACCAAATGGCGCCACAACCAATCTACAAAACTCCC
GACGCCGAGGCCGAACGCCGCCTCCGCGAGGCGGAGGAGCGCCTCCGCGA
AGCCATAGAGGAGCTCCAACGCCGCCAACGCACTCGCGGCGGCAGCGGCG
ACGGCTCCTCCCTGCCGCCCTGCGACCACGCCGGTGACGAGTCTTGTGTG
GCGAACGCAATTGGTAACCTCTGCCAAAGCTTTCTTCTTTCTTATGGAGT
GAGAGTTGGGATTGGAATTCTCCTGCGCGCCTTCAAGCTCGCGCGTGGGC
AGTCTTATTCTTCGCTCCTCGATCTTAAACAACTTGTATCTGAGAAAGAT
TTGATTGTAAGAGAAGAAGCGTGTAGAATTGGTTTACTTTTTGGTGGGTT
TACTGGATCCTATCATTTGCTTAGATGTATGTTAAGAAAATTCAGAAAGA
AAGAGACTCCATTCAATGCATATTTAGCAGGTTCAATTGCTGGTTTGTCT
GTTTTAGCTTTGGATGATTCTAATAGGAGACGCACGCTTGCTCTTTATCT
TTTGGCTAGAGTAGCTCAGTGTGCATATAATTCTGCNTAGTCGAAGAACA
AGTTTCACTTGTGGGGTAGCTATTGGAGGCATGGAGATTCTTTGCTCTTT
TCTCTAGCTTGTGCCCAGGNTATGTATCCTT
back to top