FC875482

Overview
NameFC875482
Unique NameFC875482
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length729
Libraries
Library NameType
CTVClemen1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC875482_ssr8 microsatellite FC875482_ssr8:8..19. BLAST: Citrus ESTs to Prunus persica proteins V1
FC875482_ssr132 microsatellite FC875482_ssr132:132..143. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig9863 contig Ccv1_Contig9863:105..833. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC31404D10EF CTVClemen1 Citrus clementina cDNA clone C31404D10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875482 ID=FC875482|Name=FC875482|organism=Citrus clementina|type=EST|length=729bp
GATTTAACATCATCATCATCGTTCATCACCATTTTTACGCAAAGAAACAA
ATAGTTTGATCAGTTGAAAGCAAAAAAGCATGTCCGGGCAAGACATCGAG
AGAGGGCAAAGAGCGAACAAGAACAGAACAGGCAGCAGCAGCAACAACAA
CAACGGTGCCCACCTTCCATCACCAACGTATCTGATCGAAGACACAGAGA
CCCAATGGACTTCTTGGCTCGTTCCCATGTTTGTTGTTGCTAATGTTGCC
GTCTTCATTGTTGTCATGTACATCAACGATTGTCCAAAGCATGATCAAGC
GTTTAAAGGCAAGTGCGTGGCAAGGTTCTTGGGGCGGTTCTCGTTTGAGC
CTTTGAGAAAGAATCCTCTTTTTGGTCCCTCTTCTCACACATTGGAGAAA
TTGGGTGGTCTTGAATGGACCAAAGTGGTGCAAAAACATCAAGGATGGAG
GCTTATCACTTGTATCTGGTTGCACGCCGGTATTATTCATCTCCTCGTAA
ACATGCTATGCCTGGTTTTCATTGGTATTCGCCTTGAACAGCAATTTGGG
TTCGTGCGGATTGGAGTTATTTACCTGTTATCTGGATTCGGTGGGAGTGT
TCTTTCCTGCCTATTTATTCGAAACAGCATCTCTGTTGGTGCCTCCGGTG
CACTTTTTGGGCTTCTGGGAGCAATGCTTTCAGAACTACTTACTAACTGG
AGTCTTTATACCAACAGGCTGCAGCCTTG
back to top