FC875584

Overview
NameFC875584
Unique NameFC875584
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length750
Libraries
Library NameType
CTVClemen1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC31405E09EF CTVClemen1 Citrus clementina cDNA clone C31405E09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875584 ID=FC875584|Name=FC875584|organism=Citrus clementina|type=EST|length=750bp
TTTCATATCTTTGGAGAATTTGTTGTACCTTGCTAGAAATTTTCCGAAGT
CCTTCCAGGATCTTCTGCGAAAGCAGGAAGGTGATCGGTCAGTGTGGGAA
TACCCATTCGCTGTAGCTGGTGTAAACATCACATTCATGCTCATTCAGAT
GCTTGATCTTGAAGCAGTCAAACCACGAACAATGGTGGGAGCAACATTTT
TGAAGTTTCTTTCAGAAAATGAATCAGCGTTTGATCTTCTCTATTGCATT
ACATTCAAGCTGATGGATCATCAATGGCTTGCAATGCGAGCATCATACAT
GGATTTTAATACGGTAATGAAATCCACACGCCGACAACTGGAAAGGGAGC
TTTTACTTGAAGATGTAACTCGGCTGGAAGATTTGCCCTCCTACAGCCTT
CTTTCTCGATAGAATAGCTGTTCCAAAAGCTAAAAAATGGGCTTGTAGCG
GCAAGATGCATGCTATCGTGTGGGCGCGTTCTCCTTTGATCTCATAACTA
AATGGTGCTTTGTACATGATATGGTTCCTACTTCCTTTTATAAAACTCAT
CTCAAAGCCATGCTTGTGCATTTTCCACTTGATTCTTCTAGGAAAGTGTT
GATTTTCGCAAGTTTTCTGTATCCGGAAAAAGGGGATTATTGAGTTTGTA
GGTTGAGACTAGTGTGTAGATGATTTTGTGCTTTCATGTGCGACGCTCCC
ACTCCGTGGTCTGTGGAAAATATTCCCTGGCATGATACTCAATATGTAGC
back to top