FC875586

Overview
NameFC875586
Unique NameFC875586
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length696
Libraries
Library NameType
CTVClemen1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC875586_ssr441 microsatellite FC875586_ssr441:441..458. BLAST: Citrus ESTs to Populus V2 proteins
FC875586_ssr670 microsatellite FC875586_ssr670:670..681. BLAST: Citrus ESTs to Populus V2 proteins
Ccv1_Contig12303 contig Ccv1_Contig12303:531..1226. BLAST: Citrus Unigene V1 Contigs to Populus V2 proteins
Properties
Property NameValue
Genbank descriptionC31405E12EF CTVClemen1 Citrus clementina cDNA clone C31405E12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875586 ID=FC875586|Name=FC875586|organism=Citrus clementina|type=EST|length=696bp
AACAAAAATTCCTTAAAGAAGCTCGAAAACTTACTTTATTGCACATACCA
CATATCTCTGTGTTCTTGTCCGTTGATCTGTTGTTAAAAATTGTTGTTTG
TGAGTGATAATTGACAAGTATGGCTGAAGAGATCAAGAAGCAGCAGAAGA
GCCATGAGTACGAGCCGAGTGTTGGGACGGAAGGTGCAGTGGAGACCAAG
GATCGCGGGATGCTTGATTTCTTGGGGAAGAAAGAAGAGGAGAAACCTCA
ACATCACGATCAGGGGGTGATCGCCACCGAGTTTGAGAAAGTTCATGTCT
CTGAGCCTCAGCCAAAGGTAGAGGAACACAGGAAGGAGGAGAAAGAGGAA
GAGAAGAAGCCCGGTTTCTTAGACAAACTTCACCGATCCACCAGCAGCTC
TAGCTCTTCAAGCGATGAGGAGGAGGGCGATGATGAGGAAAAGAAGAAGA
AGAAGAAGGAAAAGAAGGGACTGAAGGAGAAGCTCAAGGAGAAATTATCA
GGTGAGAAAGAAGAGGACACGACAGTCCCTGTCGAGAAACTTGATGATGT
CCATGCTCCCCACCACCAGGAAGAAGCCCATCCTGAAGAAAAGAAAGGAT
TTCTCAACAAGATCAAGGAGAAACTACCAGGACAGCAAAAGAAACCTGAA
GATCATCAGGTCCCTTCTCCTGCTGCTGCTGAGCCCCCACATCAGT
back to top