FC875595

Overview
NameFC875595
Unique NameFC875595
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length717
Libraries
Library NameType
CTVClemen1cdna_library
Alignments
Feature NameTypeLocationAnalysis
FC875595_ssr92 microsatellite FC875595_ssr92:92..113.
Ccv1_Contig10273 contig Ccv1_Contig10273:1..718. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC31405F09EF CTVClemen1 Citrus clementina cDNA clone C31405F09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875595 ID=FC875595|Name=FC875595|organism=Citrus clementina|type=EST|length=717bp
TTCCAATTTTTCATAATTTATTTAATTATTTATTTTTAGATCATCTATTC
TTCTGGTCTTCTCTATCGGCGCTTACATATACTTCAGAAGCATATATATA
TATATATATATATACATACATATTCCAAAGCTTTATTAGCTTTGCTTATT
AATTTGATCAGATAATTCCTGCCATTCAGAGGATGATGGAGTTATTTGTG
CTGGGTTGTACGGGAGTTGTGGTGTTCCTTCATGGAGCCAATTTTTTCTT
CCATGTTCTCTCCCAGCATCTCGCCGTCCGTTCTCTCAGGTAACTGAATT
TCATAGTAAACTGTTGTTCAACACTCAGCTTCTTGTCTTGTGTGTATTCC
GTCTACCTTCACAAATACGGATCTCAATTGACTTTATAACCTCTAGATGG
GAAAATATTCGTGTTGATTTTGCCATGTCTTTCCCGGAAATTAAAACTTT
GTTCGTTAATTAGAACAAGCTCTGGAGCATCATCAGGTCAATTTTCAAAT
TCTCTTTTTTTTTTTTTTAATTCTGACAGCACGTATTCATCTCTTATGCA
ACCGGTCCGATCTGAATCTGCAAATTTCTCATTGGTTAATTACAAATGTA
TGGTCATGTGATAATAATTAATTTGTACTGTTTGGAACTCTTATGTGATG
AGAAAATTTGTGATTCAATAAAGTTTTTTACACGTGGGGGATTGTGTGAT
TGGTTCAGTTTCTGGGG
back to top