FC876159

Overview
NameFC876159
Unique NameFC876159
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length658
Libraries
Library NameType
DevOvary1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC876159_ssr32 microsatellite FC876159_ssr32:32..49. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig12292 contig Ccv1_Contig12292:55..712. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32001A02EF DevOvary1 Citrus clementina cDNA clone C32001A02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC876159 ID=FC876159|Name=FC876159|organism=Citrus clementina|type=EST|length=658bp
GCTCAAACAGAGTGCACACACAGCAGCTACTGAGAGAGAGAGAGAGAGAG
TTGAGCAGTGAGAAATATGGCCGAGAAAATGGTGAAAAGCTCTTCAATAA
CTAGATGGGTTTCTCTGTTTATGTTTGTTGTTGCTCATTTGGCTTCTTCA
ATCCTAGCCGAAGATGGTTTAGTGGCTAATGGCGATTTTGAGACATCCCC
GTCGCACGGCTTCCCGAGTGAGTCCATAGCAGATGGGCCCACAGAGATTC
CAAGCTGGAAATTAAACGGCACCGTAGAGCTGGTCTCATCTGGGCAAAAA
CAAGGTGGGATGATCCTCATTGTGCCACAGGGTTCTCACGCTGTTAGATT
AGGCAACGATGCGGAGATCAGCCAGGAAGTGAAAGTTGAAAAAGGGTCTA
CGTATTCCGTTACGTTCAGTGCGGCGCGCACGTGCGCGCAGCTGGAGTCG
CTGAACGTGTCCGTGCCACCTGCATCACAGACCATAGACCTGCAGACATT
GTATAACGTGCAAGGGTGGGACCCGTACGCGTGGGCTTTTGAGGCAGAAG
ACGACAATGTGAAGCTTCTTTTTAAGAACCCGGGCATGGAAGATGACCCC
ACTTGTGGGCCCATCATTGATGATATTGCGATCAAGAAGCTTTTCGCTCC
TGATAAGC
back to top