FC876161

Overview
NameFC876161
Unique NameFC876161
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length598
Libraries
Library NameType
DevOvary1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig365 contig Ccv1_Contig365:224..822. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32001A05EF DevOvary1 Citrus clementina cDNA clone C32001A05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC876161 ID=FC876161|Name=FC876161|organism=Citrus clementina|type=EST|length=598bp
TCGCCGGGGCCATCTATCCCGCGTATTCCTTGGCGATAACAGGAACCAGA
TCCTTCGGTTGACTTGCTCCGCTGCCAATTTCATATAGAGCATACAATGG
CCGGGAACCGATGGATTAGGCCCGAGGTGTTTCCACTGTTCGCGGCTGTA
GGCGTTGCTGTCGGGATCTGCGGAATGCAACTCGTCCGCAATATCTGCAT
CAACCCTGAAGTCAGGGTGACCAAGCAAAACAGAGCTGCAGGAGTTTTGG
AGAATTATGCTGAGGGAGAAAAGTATTCTGAGCATTTCCTAAGAAAATAT
GTCCGCAACAAGGCCCCGGAAATCATGCCGAAAATCAACAGCTTCTTCAC
CGACCCTCAGTGAAGATAGTTGCTTCCTTTGAGAATTTAATGGTGTTTTG
TAGTGGTATGTGTGAACTTCAGGTCTCATATACCAAATGGAAATAAGATT
TGGGTGGATATAAACACTTTGATTCGTGTTTGTCTGAAATGGATCAGTGT
CTCCAAGACAACACAGTTAATTGATAGTGCTCTGTCTTTTATTACCTTTA
CCGTTGAATTCTACTCCTTTTCTGTAATATGTTATTTTTCTATTCTAG
back to top