FC876175

Overview
NameFC876175
Unique NameFC876175
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length657
Libraries
Library NameType
DevOvary1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC876175_ssr18 microsatellite FC876175_ssr18:18..32. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig9113 contig Ccv1_Contig9113:74..730. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32001C01EF DevOvary1 Citrus clementina cDNA clone C32001C01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC876175 ID=FC876175|Name=FC876175|organism=Citrus clementina|type=EST|length=657bp
AAAAAAGAAAGAACACAATCATCATCATCATCACAACAAACAGATTAAAA
AAAAAAACAACAATAACAAATTCTATCCTCAAACAAAAGAAAAAAAAACC
ACCGCCACCCACCACCCGCCACCGTCCGATCATATTTTGCCGGCCAACAT
CATCCCCGATCATCGATTTTGTGATCTGGGTCGATGGCGGAATCGGAGAA
GAATCTCGAAATTTCAAGCAAAGCGTCATCGTCTTCTTCTTCGATGTTGT
TGAATCGGTCGTTTACTATGCACGCAACCGCAGCTGATTCTTCTCTCCCG
AAACTCAATTATGCCTCTCTCAATCGGGCCGTTTCGAGCAATAAGTTTTA
CAATTCGATGGAATCAGTCTTATCTGCTAGCAATTCATTCAAAGGTAAGG
TCAAGCAACTTCGTAATTTATTTGAGCCCAAAAAATCATCCAAAAAAATT
AATTTAAACGAACCCGAATCCCCGCAACAGCACCACCTCATCAAGTTAAC
AAAACCCGTGAAATCTTTATCTTTGTGTTATAATAATGAGTCTTCGATTA
GATTACCGGGTACTGAGGATCGAATTGTTGTTTATTTAACGAGTCTGAGA
GGGATTCGAAGGACTTTTGAGGATTGTTATGCGGTTAGGATGATATTTAG
AGGGTTT
back to top