FC876210

Overview
NameFC876210
Unique NameFC876210
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length713
Libraries
Library NameType
DevOvary1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig6418 contig Ccv1_Contig6418:49..761. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32001G03EF DevOvary1 Citrus clementina cDNA clone C32001G03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC876210 ID=FC876210|Name=FC876210|organism=Citrus clementina|type=EST|length=713bp
ACCCCAAATCAAACGAAATTGAATCGCAGGCCATAATTAGAATTTCTATC
TAATTGATCCCGATTTCACTTCTTTTGATCGATTCTGGCTTGAAATGTGA
AAATTGCCGTGAAATTATCGGCCTTTGGCGGTTAATGGTCCTCGAGCTTG
AAATTTTTTTTCAGAGAAATCGGTCCACTTTTGTCGTTTTTGAGCTGATT
CGAAGTGTAATTTAAGGTTTTTTTGAAGAAACGGTGATGGACTTTGAGGT
TTTCGACAGTAGTGGCACGGATGATGACCTTCCTCCTTCACATCACAATA
GATTTCAGAGAGGGGTTCGCCCCACTGGGAATGGAAGATCTGCAGTTATA
GGTTCCGCTTCATTACCTAGGATGCAAAATGACATGGCAACTCAGATCCA
CAGCGTTGAGCAGGATGCATACAGTTCAGTCCTGCGGGCCTTTAAAGCTC
AATCTGATGCCATTACTTGGGAGAAGGAGAGTTTAATTACTGAACTTAGA
AAGGAGTTGAGAGTATCGGACGAGGAACATAGGGAGCTTCTATCAAAGGT
TAATGCTGATGACATTATCCTGAGGATAAGGGAATGGAGAAAGGCAAGTG
GCCTCCAGCCTGGCATGCCCAGCATCCCTCAGCCGGTCCATGATCCTGCA
CCCAGTCCTACCCGTTCTGCATCACGTAAGAAAACAAAAACATCGCAGTC
AGTAGCTTCATTG
back to top