FC876331

Overview
NameFC876331
Unique NameFC876331
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length634
Libraries
Library NameType
DevOvary1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC876331_ssr120 microsatellite FC876331_ssr120:120..131. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32003E02EF DevOvary1 Citrus clementina cDNA clone C32003E02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC876331 ID=FC876331|Name=FC876331|organism=Citrus clementina|type=EST|length=634bp
GTTGGGGCTTGGCGGGCGATGTCAATTGGTTGGACTTTTGCTACTTCCTT
CTTCTCTTCTCTGTTCTTACCCATCGCTCTTCTTAATGTTCGTTTGATTG
GACTGAAACAACTTCGAACTTCTTTCTTTCTGTTCGTTTTGAAATCCCAT
TTCGTAGATCCACAAAATCGAGTCTTTGTTTGATGGTGTGAGAATGGGAG
GGCAGTGCTCAAAGGGTTCCTCTAAAGCCGACAAAAACAATACAAGGCGT
TCGATTTCTCTCAAGTCAAATGGGTTACAGAATCATAAACTGAACCCATC
GCCATCACCGCTGGAGCAGCAGCACAAGGGATTTTCTTCCTTACCTAAGC
CTCAATCTGATGATTTTTATGATGGCATTCCGCGGTTCGATGGGGGGCTT
TCCCAGAAATCTAAGTCTGTCAGGTCTACTCAGGCTGCTGTTGCAAAGGT
TTCGGAGGTAAGTGCACGTTTAGGAAGAGCAGGTACTGTTGGACTAGGAA
AGGCAGTGGATGTCTTGGATACACTTGGGAGTAGCATGACAAATTTAAAC
CCTAATAATGGATTTTCTGGAGTGGGAACTAAAAGCAATGAACTCTCAAT
ATTAGCTTTTGAGGTTGCAAACACGATAGTCAAG
back to top