FC920177

Overview
NameFC920177
Unique NameFC920177
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length693
Libraries
Library NameType
RVDevelop1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC920177_ssr9 microsatellite FC920177_ssr9:9..18. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig10361 contig Ccv1_Contig10361:2..695. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32005A05EF RVDevelop1 Citrus clementina cDNA clone C32005A05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920177 ID=FC920177|Name=FC920177|organism=Citrus clementina|type=EST|length=693bp
GCTTGAGTTCTCTCTCTCTTCTCTCTCAAAATCAAAATGGTAGCTCATTC
ATTATCTATTGTGCTTGCTCTCGGCTTGCTCTTGCTCTTATCTGGTCCTG
CATTTGCTGCCAAGTACTTTGAAGGGTACCTCCCAAATGGCGACTTTGAG
GAACTACCAAAACCAACTAACCTCAAAAAGACAGTTCTAGTTGGGAAACA
TGCACTTCCCAAATGGGAAATCAATGGCTTTGTTGAATTCATCGCCGGTG
GGCCCCAACCCGGTGGCATGTTCTTTCCAGTATCTCATGGAGTCCATGCC
ATTAGGCTTGGCAATGAGGCCTCGATCTCTCAAACTATAACTGTAAAACC
AGGAGCCCTTTACGCACTAACATTTGGTGCATCAAGAACTTGTGCTCAAG
ATGAGGCGTTGAGAGTCTCTGTGCCTCCTCAGTCGGGGGATCTGCCTCTG
CAGACATTGTATGATATTAACGGTGACACTTATGCTTGGGGATTTAGAGC
CAAAACTAACATTGTTACAGTGACATTCCACAATCCTGGTGTTCAAGAGG
ATCCTGCTTGTGGTCCACTTATCGATGCTGTTGCTATTAAGGAGCTCTAT
CCGCCAATGCCGACAAGAGATAACTTGGTCAAGAATCCTGGCTTTGAAGA
GGGTCCACATCGGCTAGTAACACTACTAATGGAGTCCTTCTTC
back to top