FC920188

Overview
NameFC920188
Unique NameFC920188
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length667
Libraries
Library NameType
RVDevelop1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15215 contig Ccv1_Contig15215:687..1353. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32005B05EF RVDevelop1 Citrus clementina cDNA clone C32005B05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920188 ID=FC920188|Name=FC920188|organism=Citrus clementina|type=EST|length=667bp
GGAACTTCAAAGGAGAAGAGTGATAGGTTGCACAAGGTCCTTGAATTTGT
CAGCACTGTGCATGATCTCTGTGGGGTGCTTGGCATGGACTTCTTCAGTA
CTGTAACTGAAGTTCATCCAAGCTTAAATGACTCTACTGGTGTGCAATCC
AAAAGCATTAGCAATGATACCCTTGCTAGGCTGGCTAAAACTGTGCTGGC
ACTTAAAGAAGATAAGAAGCAGAGGCTTCATAAGCTTCAAGAATTAGCTA
CTCAGCTAATTGATTTGTGGAATCTGATGGATACTCCCTCAGAGGAACGG
AGATTGTTTGACCATGTTACCTGCAACATATCAGCTTATGTAGATGGAGT
GACTGTCCCTGGCGCTCTTGCTCTGGATCTGATTGAGCAGGCTGAAGTTG
AAGTCGAAAGGCTTGATCAACTGAAAGCTAGCAGAATGAAGGAAATTGCT
TTCAAAAGGCAAGGCGAACTTGAAGAGATATTTGCTCGTGCTCATATAGA
GATAGATCCGGTGGCTGCTCGAGAAAAAATTATGACACTAATTGACTCTG
GGAATGTTGAGCCTGCTGAATTATTAGCTGACATGGATAATCAGATAGCC
AAAGCTAAAGAAGAAGCTCACAGCAGAAAAGAAATTTTGGACAAGGTTGA
GAAATGGATGTCTGCCT
back to top