FC920415

Overview
NameFC920415
Unique NameFC920415
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length687
Libraries
Library NameType
RVDevelop1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC920415_ssr197 microsatellite FC920415_ssr197:197..206. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig14140 contig Ccv1_Contig14140:1..688. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32008A12EF RVDevelop1 Citrus clementina cDNA clone C32008A12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920415 ID=FC920415|Name=FC920415|organism=Citrus clementina|type=EST|length=687bp
GTTGAATAAATTAATTTCCTTGATAATAAAAATAAAAAATCAAACCAACA
CAAATACAAATACGAAATTCATTCGTTGAAGTGTTAACATTTGTCATCAT
TTTTATAATTTCCAATTTTCGTTTGCTTGCTTTGGTGGTAATTGGTAATA
GAAAAAAAGGCCATAAAAGTAAAACAGTGAGCAAAGAGGGACGGGGGAGA
GAGAGAGCGAGGCAGAGGCGCCGCACAGCACAGCACTAATCTCATCGACA
TCGTCGTCAGATATCAGTTAGACAGATCTGATCTGGAAAACTGAAGCCGG
GTTTGCAAACAGAAGACAAATCAATGGGTGTCTCAAAATCCTTGGTTTTC
TGTGTGTTGGTCTTCCAATTGCTTTCCCTTTCATCGGCCGAGATCCGATT
CAACGAGATTCGAAACGATAACCGCCCGATAATCCCGTTCGACGAGTTTG
GGTTCACACACCGTGGCCGTCTCGAGCTCAACGTTTCCAAAATCTCCCTT
TCAAAATCCAACCCGGACCTCGACTTCTCCAAGGTCGGATTCTTCCTCTG
CACTCGCGACTCATGGCTCCACGTGCTCCAACAGCTCGAAGACGGAGAGA
TCACGTGCGCTCTCCAGTCCGATCTAATCAAACACGTCTTCACCTTCAAT
AACCTCACGGCAAATCTGAGTACAACACCATCTATTC
back to top