FC920473

Overview
NameFC920473
Unique NameFC920473
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length113
Libraries
Library NameType
RVDevelop1cdna_library
Properties
Property NameValue
Genbank descriptionC32008H01EF RVDevelop1 Citrus clementina cDNA clone C32008H01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920473 ID=FC920473|Name=FC920473|organism=Citrus clementina|type=EST|length=113bp
TATCGTATCTGCATTCGCGCAGTAATGTCTTCTTCAACAATTCCGAACTC
ATTTGATGATGTCACCGATTTTGTAGCAAATAGAGGCAATGGAATAACGG
GTCTAGTTGATTC
back to top