FC920477

Overview
NameFC920477
Unique NameFC920477
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length700
Libraries
Library NameType
RVDevelop1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14116 contig Ccv1_Contig14116:133..833. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32008H05EF RVDevelop1 Citrus clementina cDNA clone C32008H05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920477 ID=FC920477|Name=FC920477|organism=Citrus clementina|type=EST|length=700bp
GATTCAATAAGTAGCCCTCGCAGAACAAAAAATGATTTTCCTACTACTCC
TCTCCGTTTTTCTTCGCGGAGCTTCTTCATCAATCCTTTCCGAAGACACA
CCTATTAGCTTCTCATTTCCCTCATTCGCCAAAGACAGTTGTGACAATAA
GACCCTCATTTGCTACGGAGCGATTGAAAGTTCCGGCGCCTTAAGCATCA
CACCAGGCCCTCCACCAAACCTGCCGATCAGAAAGGTTGGACGGGTTTTA
TACGGCAAGCCTCTGAGTTTACAGCGATCTTTTATTGATACCACCATCAC
CATTAAGATCTCACGCCATCAGAATTACACTGATCGTGCCGGAGATGGCA
TGACGTTCATTTTTGCAAGCGATAAAAACGGTCCATCAGCAAAGGGCGTC
GGCGAATATCTTGGACTGCAGTCTTCACCAGGCGATAAATTTCCTCCATT
AGCCGTGGAGCTGGACACATGCCTGAACAAGAACCTGAATGATCCAGATG
ATAACCATATTGGCATCGACATAAACGGAATCGAATCAAATCCAGTTAAT
AGTCTGCTTGACGTTGATCTCAAAAGTGGACGAGCAATCCAGGTTCGAAT
TTATTACAATCCAGACTTTGGACAACTCTCTGTTTATGCGGCATATTCGG
GGGAAACACTTGTGAAGGTGGTTGAAAACCCATTAACCTGTCAGATATAT
back to top