FC920480

Overview
NameFC920480
Unique NameFC920480
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length727
Libraries
Library NameType
RVDevelop1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC920480_ssr17 microsatellite FC920480_ssr17:17..36. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig9395 contig Ccv1_Contig9395:367..1093. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32008H08EF RVDevelop1 Citrus clementina cDNA clone C32008H08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920480 ID=FC920480|Name=FC920480|organism=Citrus clementina|type=EST|length=727bp
GGCAGTAACCCCCATATCTCTCTCTCTCTCTCTCTCTTCATATATTTAAT
TATTCTCAATTTCTCATATTCAATTCAGTAGTCTTTTTCTTTTTCTTTTT
TGCTCCTTTTCAAGCCCTCGAAGAATCGCTGCGCTTCACGCCTAGCTAGT
AATTCGATTCAACCGGGGGTTCGTGTTTGGATATTCCTTTTCTTTTCTTA
GAAACACAAAGAAGTTGATTTTGTCATTAATAATTCATCAATGGGTTTGG
CTTCGGCTTTGTTGGAGATATTGCAAAAACCCTCGATGGTTGACGTGATA
AGGGAGCTTATGATGTTAATGGCGCCTTTATGGATTGCCGTAATTGTTGG
GGTCCTTGTTGGCTGGGCATGGAAACCCAAATGGGCTAATTTAGGCTTGA
TGGATTCTTCCGTCTCCATTTCCAAGGAATCGCATTCACGTACAGAAGAT
GATGACAGTACAACAACTTTCACTGCTTTTAGGAATTTTTTTAAGTTTCA
GCTTCCCACTTGCATTTCTGCCACTTCTGATTATGGGATTCAAAAGGATG
TCCCTTCTACCTCCAATTCCATTTCTCCCTGCAGTTCCTCGCAGGCTCAC
CGCCGTATGGAGCAATCTAGTTTTGTCACGGAAGATGATTTGGAGCATTT
GTGTAGGCTTGTTGAGGAGAAAGACGGGGGTCCTGTTTGGATCAGATGAT
GGATCGNTCTACGCCCACTATGGCCTA
back to top