FC920650

Overview
NameFC920650
Unique NameFC920650
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length718
Libraries
Library NameType
RVDevelop1cdna_library
Properties
Property NameValue
Genbank descriptionC32011C06EF RVDevelop1 Citrus clementina cDNA clone C32011C06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920650 ID=FC920650|Name=FC920650|organism=Citrus clementina|type=EST|length=718bp
GAGGAGTGATTCAATACTCTCTCCACTTCGGAGAGTTGTGGGAGTTTAAT
TTTCACGATGGGTAGAAAACATCCTTTAGCTAATTTCTTGATTCTCCTCT
TGAACTTGGGTACGTTGCTATCTTCTTTAGCATGTCCATATTGCCCTTAT
CCTACTCCTCCCCCTCCGTGTCCCCCAACATTTCCACCAAAACACCCTCC
ACATGTAAAGCCACCTTTCCACCCCAAACCACCGCATCACAAGCCACCCC
ATGTCAAACCACCGCACAAGCCCCCGTATGTTCCTAAACCACCTTATTCC
CCAAGCCCTAAACCGCCTTACGTGCCAAAACCACCTCATACTCCAGTCCC
TAGGCCACCATATTTCCCCAAACCACCTTACACACCAAGGCCTAAGCCAC
CATATGCGCCAAAACCACCTTATACGCCAACCCCTAAGCCACCATATTTC
CCCAAACCACCTTACACACCAAGGCCGAAGCCACCATATGTGCCAAAACC
ACCTTATACGCCAGCCCCTAAGCCACCATATTTTCCCAAACCACCTTACA
CACCAAGGCCTAAGCCACCATATGCACCAAAACCACCGTATACCCCAACT
CCTAAGCCACCGTACGTCCCATCGCCACCTTATACCCCTCGCCCTAAACC
ACCGTATGTACCATCACCACCTTATACCCCTAGCCCTAAANCACGTATGT
GCCATCACACCATATACC
back to top