FC920653

Overview
NameFC920653
Unique NameFC920653
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length695
Libraries
Library NameType
RVDevelop1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC920653_ssr223 microsatellite FC920653_ssr223:223..240. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig14175 contig Ccv1_Contig14175:1..692. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32011C10EF RVDevelop1 Citrus clementina cDNA clone C32011C10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920653 ID=FC920653|Name=FC920653|organism=Citrus clementina|type=EST|length=695bp
GCTCCCCGATCCCAACAGAGTAACAAACCATCCCCAAAATCAAGAAATCA
AATTATCAGATTCCCAAAACCCTAAAATTTTTGTAAAAGTACAACTAATA
TAACGCAAACAAAGAAAAATTCTAGAGAGAATCTCTGAGGATTAGCCCTA
AAATGGCGTCCTCTAAAATCATGAAATCTTCAAACACACGAAATTCGGAT
CTTTCAAAACGGTCCTCTACTGCTTCTTCTTCTTCTTCTTCTACAAAGCA
GCAGCAAGGGGCACTAACTGACGCGTCGAAGTTCGCTTCCGCAATGACGG
TGGACGGCATTTTACGGAACGTCTACAACACGACGACGGCGTCGACGACG
GACGCCACTCTTCTCGACGCGCAAATCACTCTGGTCGACACGAACTCGAA
TCTGATCGCGAACGAGAACGACCAGAACGGCGCCGTCTCGGCGGGGGCGA
TGAGGAGTGTGGACGACGTGTGGAGGGAGATCGTATCGGGGGAGAAGAAG
GAGATGAAGGAGGAGGCGATTGACGAAATGATGACTTTGGAGGATTTTTT
GGCAAAGGCGGGAGCTGTTGAGGATAGTGTTGGCGGTGATGACATGGACG
TGAAAGCTTTTGCGAATGTTACTGAGAGGTTGAGTGGTGGAGTTTATGCG
TTTGATCAGCCGGCGGCGGCGAGTCCCTTTCAGGTTGAAGGGGCC
back to top