FC920660

Overview
NameFC920660
Unique NameFC920660
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length669
Libraries
Library NameType
RVDevelop1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig11786 contig Ccv1_Contig11786:1..650. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32011D05EF RVDevelop1 Citrus clementina cDNA clone C32011D05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920660 ID=FC920660|Name=FC920660|organism=Citrus clementina|type=EST|length=669bp
GAACTCGAAGTCGAAGCACAGGAACAGAAAACAAACAACTGANCAAAAAA
AAAAAAAAAAAAAAACAGAGGAGCATTGGCAACAAAATCTCAAACTTCAT
TACATTCCTTCTCTTCATTTCCGAGATGAATGGGGAAAGGCAAGAAGAGA
AAATGGAGAGAGTTGTGTTCATGTGGGGCTATCTTCCCGGAGCGTTGCCG
CAGCGGTCGCCGATTTTATCCCCGCTCGTCGTCAGATTGCCGCTTACTGT
TGGGTCCGCCTGGAGGGATGTTTGTGGTGGCGGTTGCGGATTCGCCATGG
CCATTTCTGACTCCAGAAAGCTCATTACTTGGGGTTCTACAGATGACCTA
GGTCAAAGCTATGTGACATCCGGGAAGCATGGGGAAATTCCCGAGCCTTT
CCCTCTCCCAACTGAAGCCTCTATAGTAAAAGCTGCTGCAGGTTGGGCAC
ACTGTGTTGCAGTTACAGAGGGTGGAGAAGTTTATACATGGGGATGGAAA
GAGTGTGTTCCTTCAGGGAGGGTCTTCGGAGATCTATCCACAGGGACAGG
TTTAGATAAGGATGTGTTTGAAAGACAAAGTTCATTCTTGACGGAGCAAG
TAAGCCCGCGTTCTCAAGTCTCAAGATCAAGTGGTGGAACCTCGTCTGGT
ACTGATGGTAGAGGAAGTG
back to top