FC920662

Overview
NameFC920662
Unique NameFC920662
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length707
Libraries
Library NameType
RVDevelop1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC32011D07EF RVDevelop1 Citrus clementina cDNA clone C32011D07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920662 ID=FC920662|Name=FC920662|organism=Citrus clementina|type=EST|length=707bp
CGGGGATCATTCCACACTGGGGATTTCGGTATTCAAGTTGGGTTCTTCTT
GGTTGTTGCTTGAATTCTAGAAAGAGTTGATAGAGACAGATATGTAGTCT
AGAATTGGGTTTTGCTTTTGGGTCTGCAAAGCTAGAGATTATTAGCACAA
CAGGTTGTCTCTTTTGGGCGATTATTTGGACAAACTATTAGGAGTTTTTG
GTTTGAAACTCAGATCAAAGTTGGTTTGAAGAGTGATGAGTGATAAAGAT
TGAAAATTTGTTATTTCTGGAAGTGGGTTTTGGAGAGTGCCTTTCAGTGA
CTTGTTTCATGCATTGAATTTACAATGACGATTCATTAGTTCTGAGAGGT
GCGTTTTGGTTCAAAGAAGCTGATATGTGAAGTTAAAGGCAGAGTATGGT
TCATGGGTAGCAAAGTTTAGATATTCATGCAGTTTTGTTTGTTTAAATCG
GTTGGTTTTTGCCGCAAGAGATGTTTGATAGAAGCTTGATAGTATCCGTC
AATACACTGAATTACCCATCTTGTACGTTGGGTTTTGTAAATAGTTATAG
AACTCTATCTAGAACAAGATTGAATTCAAATCCACTGCTGGCTATGCCCC
CATCTTCAGTTCTCTTACAGACAGATGAAAGCGGGAAATTTCAAGAATCG
AAGAAGAGTTTTGGTTCAAAGCAGCTCCATTTTGCAGTGATGCGTTGCTT
AATCAGC
back to top