FC920675

Overview
NameFC920675
Unique NameFC920675
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length735
Libraries
Library NameType
RVDevelop1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15106 contig Ccv1_Contig15106:3..737. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32011E12EF RVDevelop1 Citrus clementina cDNA clone C32011E12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920675 ID=FC920675|Name=FC920675|organism=Citrus clementina|type=EST|length=735bp
GGTATAATCTGCTTCTCAAATGTCTCTCGTTTCCAGCTCTCACTTTTCTG
TCAGCCGATGGCTTATCCCTTAGCGCCTTGATCCAAACAGTCTCTCGATT
CGCGGCGACAAAAGCGCTGTCGTCTCTTAGATTTACTTTTATAGATCGAT
CATTTGTCCTCCAAATTACGGAAAAAAAAGGGCGAAAATAGTTAGGGTTT
TAGCGAGTTAGGGTTTCGAAGAGCATCGATATAATGCCTTCGGTGCCCAA
AGATCCGTTAATTCCTTCATTGACACGTTTCAATAGTGGATTGTCTCCTC
ATCGTCTGAAACATCTCGAGAAAAGTGATCGGCGTGGTAATCTTAGTTAA
CATTTGCTTTTTTTGTTTTTGTTTTTATTTCCCCTATTTCTTTTTTCCTT
TTCATCTTTGAATTTGTCTCGGCCTTCTTTTCCCAATTTCTCCGTGATCT
CGTCGTCCGTACGATATTTTGAGGTTCGATTGACTCCGAAACGTTGACTT
TTTTGGAGCATTTTTGTTGGCTTTGACATCTTAGAAGTTCTGATTTGAAA
TTGTAGCCCTCCTATTGTAATCTATGGACATTGGCTCTCCTTGTGAGAAG
GCAATATCTAAGGCATTACCTGGAGGTCTAGTAAATGCCCTTGATGGAAA
CAGCGACGAGGTTTTGAGCATTAAGGATTCGAGTGAATGTAATACATCTG
ATGGGGGTGTGGTGAGTCATGTGGAGAAGGATTTG
back to top