FC920676

Overview
NameFC920676
Unique NameFC920676
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length657
Libraries
Library NameType
RVDevelop1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14116 contig Ccv1_Contig14116:133..790. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32011F01EF RVDevelop1 Citrus clementina cDNA clone C32011F01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920676 ID=FC920676|Name=FC920676|organism=Citrus clementina|type=EST|length=657bp
GGATCAATAAGTAGCCCTCGCTCAAAAAAAATGATTTTCCTACTACTCCT
CTCCGTTTTTCTTCGCGGAGCTTCTTCATCAATCCTTTCCGAAGACACAC
CTATTAGCTTCTCATTTCCCTCATTCGCCAAAGACAGTTGTGACAATAAG
ACCCTCATTTGCTACGGAGCGATTGAAAGTTCCGGCGCCTTAAGCATCAC
ACCAGGCCCTCCACCAAACCTGCCGATCAGAAAGGTTGGACGGGTTTTAT
ACGGCAAGCCTCTGAGTTTACAGCGATCTTTTATTGATACCACCATCACC
ATTAAGATCTCACGCCATCAGAATTACACTGATCGTGCCGGAGATGGCAT
GACGTTCATTTTTGCAAGCGATAAAAACGGTCCATCAGCAAAGGGCGTCG
GCGAATATCTTGGACTGCAGTCTTCACCAGGCGATAAATTTCCTCCATTA
GCCGTGGAGCTGGACACATGCCTGAACAAGAACCTGAATGATCCAGATGA
TAACCATATTGGCATCGACATAAACGGAATCGAATCAAATCCAGTTAATA
GTCTGCTTGACGTTGATCTCAAAAGTGGACGAGCAATCCAGGTTCGAATT
TATTACAATCCAGACTTTGGACAACTCTCTGTTTATGCGGCATATTCGGG
GGAAACA
back to top