FC920682

Overview
NameFC920682
Unique NameFC920682
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length671
Libraries
Library NameType
RVDevelop1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14145 contig Ccv1_Contig14145:1..671. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC32011F11EF RVDevelop1 Citrus clementina cDNA clone C32011F11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920682 ID=FC920682|Name=FC920682|organism=Citrus clementina|type=EST|length=671bp
GGAACAAAGCACAATAAGTTGGCAAAAAAATGGCACCAGTTAAAAAACGT
GCATGCATTGGTCTTTTACTCTTGCTATGCTCAAGCTTCAGTTCTGCCTC
CAGGATTCTCCTGGATCACAACCCTGCTGACCAAAAACAAAAAGATGCTG
ATAACCATAACATCGGTAATAGTCCCATCAATGAGCAAGGGGCTAGTGGA
TTCGGGTATGGACGTGGCACTGTAGTTGAGTTAGGAGCTGGCACTGGATA
TGGTTATGGAAGTGGATCTAGTGGGTCTGGGATTGGTTACGGAGCTGGTA
GTGGTGGTGGTAGTGGTGGTACTGGTATTGGGTATGGGGCAGGTTCAGGA
TCAGGTGGGGGTACTGGAGTTGGGCAAGGAACTGGCAGTGGTTACGCGTC
CGGAGGTGGCACTGGCACTGGTATCGGTATGGGAACTGGCAGTGGAACAG
TTATCCCTGGCGTAGGAGTTATTCCTGGTGCTGGAGGCACCGGTACTGGT
ATTGGTATAGGAACAGGCAGTGGAACAGTTATCCCTGGCGTAGGAGTTAT
TCCTGGTGCTGGAGGCACCGGTACTGGTATTGGTATAGGAACTGGTAGTG
GAACAGTCATCCCAGGCGTAGGAGCTACTCCTGGCTCTGGAGACACTGGT
ACCGGTATTGGTATAGGAACT
back to top