FC920686

Overview
NameFC920686
Unique NameFC920686
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length745
Libraries
Library NameType
RVDevelop1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig7889 contig Ccv1_Contig7889:122..874. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of FC920686 vs. ExPASy Swiss-Prot
Match: CCA21_ARATH (Cyclin-A2-1 OS=Arabidopsis thaliana GN=CYCA2-1 PE=2 SV=2)

HSP 1 Score: 87.8113 bits (216), Expect = 6.715e-17
Identity = 65/178 (36.52%), Postives = 94/178 (52.81%), Query Frame = 2
Query:  119 MPRSSSRHVNINKENKTHAKIEEPTSRITRAKAKALGTSGGIFPSSKPTFKPDHKHVLRMNSKRGASDENKASVTATSGIQHKRRAVLKDVTNICENSHRNYSSFAKIQTRKQPSSSPPKKIAKVSSDVCAENLLVEEDVKEKLAEELSKIRMGEPQEVT---ENTSECGKADRNHPT 643
            M R+SS+H N  KE  + +KI +   R+TR++AKALG S      SKP FK + K V R ++KR ASD    ++T  +    KRRAVLKDVTN    S  +     K+           K+  K +  +  + L+  +  K KLAE+LSKIRM E  + +   +   +C + DR+  T
Sbjct:    1 MHRASSKHTNAKKEAISTSKIRDNNVRVTRSRAKALGVSNS---PSKPAFKHETKRVARPSNKRMASD----NITVCN---QKRRAVLKDVTNTLAESIISTEGNVKVAC---------KRGGKETKQIEEDGLVDVDGEKSKLAEDLSKIRMVESLDASASKQKLVDCAEEDRSDVT 159          
BLAST of FC920686 vs. ExPASy Swiss-Prot
Match: CCA21_ORYSJ (Cyclin-A2-1 OS=Oryza sativa subsp. japonica GN=CYCA2-1 PE=2 SV=1)

HSP 1 Score: 79.337 bits (194), Expect = 2.388e-14
Identity = 63/195 (32.31%), Postives = 87/195 (44.62%), Query Frame = 2
Query:  155 KENKTHAKIEEPTSRITRAKAKALGTSGGIFPSSKPTFKPDHKHVLRMNSKRGASDENKASVTATSGIQHKRRAVLKDVTNI-CENSHRNYSSFAKIQTRKQPS---------SSPPKKIAKVSSDVCAENLLVEEDVKEKLAEELSKIRMGEPQEVTENTSECGKADRNHPTHVSEKPFGLQAINERRKQLCEE 709
            KEN      + P+ RITRA+A A     G  PS     + + K   +  +KRGA DE  ++ TATS  Q KRR VLKDVTNI C NS +N ++ +K+Q + +P+             KK+ K+     A    V   +  K +EE  K+ +    E   N  E            +E    LQ I   R   C E
Sbjct:    5 KENPVLTACQAPSGRITRAQAAANRGRFGFAPSVSLPARTERKQTAKGKTKRGALDEITSASTATSAPQPKRRTVLKDVTNIGCANSSKNCTTTSKLQQKSKPTQRVKQIPSKKQCAKKVPKLPPPAVAGTSFV---IDSKSSEETQKVELLAKAEEPTNLFE------------NEGLLSLQNIERNRDSNCHE 184          
The following BLAST results are available for this feature:
BLAST of FC920686 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 2
Match NameE-valueIdentityDescription
CCA21_ARATH6.715e-1736.52Cyclin-A2-1 OS=Arabidopsis thaliana GN=CYCA2-1 PE=... [more]
CCA21_ORYSJ2.388e-1432.31Cyclin-A2-1 OS=Oryza sativa subsp. japonica GN=CYC... [more]
back to top
Properties
Property NameValue
Genbank descriptionC32011G04EF RVDevelop1 Citrus clementina cDNA clone C32011G04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920686 ID=FC920686|Name=FC920686|organism=Citrus clementina|type=EST|length=745bp
GAGAATCACAATTCACGCACATCCTTCACTCTCTTTTCAAGAGCTCTTTT
TGACCCGATTCGAAAGGTCTCGAAGCTCCAAGCCACTCAGTCCAATGAAC
AGCATTTCAGATTAAGTCATGCCTCGCTCTTCTTCAAGGCATGTGAACAT
AAATAAAGAAAATAAAACTCATGCCAAAATTGAAGAGCCTACTTCACGGA
TCACACGAGCAAAAGCTAAAGCCCTGGGAACATCAGGAGGGATATTTCCC
TCCTCAAAACCTACCTTTAAACCAGATCACAAGCATGTTCTAAGAATGAA
TTCCAAAAGGGGAGCGTCGGATGAGAACAAAGCTTCTGTGACTGCTACCT
CAGGCATTCAGCATAAGAGAAGGGCTGTACTTAAAGATGTAACCAACATC
TGTGAAAATTCGCATAGAAACTATAGTAGTTTTGCTAAAATTCAGACTAG
AAAGCAACCTAGTAGTAGTCCTCCAAAGAAGATTGCAAAGGTGTCTTCAG
ATGTCTGTGCAGAAAATCTACTTGTTGAAGAAGATGTAAAAGAAAAGTTA
GCTGAAGAATTGTCAAAAATTAGGATGGGGGAACCACAGGAGGTGACAGA
AAACACAAGTGAATGTGGCAAAGCAGATCGGAACCATCCAACACATGTTT
CAGAGAAACCTTTTGGACTCCAGGCCATCAATGAGAGAAGAAAACAACTG
TGCGAAGAACTGCATCAAATGTCCAGCATGTGAATATTGATCAAC
back to top