FC920689

Overview
NameFC920689
Unique NameFC920689
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length689
Libraries
Library NameType
RVDevelop1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig837 contig Ccv1_Contig837:632..1320. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32011G08EF RVDevelop1 Citrus clementina cDNA clone C32011G08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920689 ID=FC920689|Name=FC920689|organism=Citrus clementina|type=EST|length=689bp
TTGAACAAATTTCGAATCCAAGCAAATGGCGGAAGAAGAAGGTTCACAGA
CGGTGGCGGAGCAAACTGCGCAACCCACAGAAACAGTAGGAACCACCCAA
GCCTCGGTCGAAGCCACTATGGAATCTGTGACTGTGAGCGGTACCGAGTC
GACATGCAACAACAACTGTGAAACTTCCGGTGCCATCGCCGACGGAGAAC
GGGAGAAGACGGTAGAGTTTGCAGACGAGTTGATGGAGAAAGGAACCAAT
GCTTTGAAAGAAAGTGATTACGGCGAGGCTGCTGAGTGCTTTAGCCGTGC
TTTGGAGATCAGGGTTTCTCATTATGGTGAACTTGCTCTTGAGTGTGTAA
ATGCATATTATCAATACGGACGTGCACTGCTGTACAAAGCTCAAGAGGAG
GCAGATCCATTGGTTTCAGTGCCTAAAAAGGAGGGTGATTCTCAACAAGG
CTCTGACAAAGATGACTCTGTTAAGAATGCTGTTAATGGAGAATCTTCGA
CGGCTTCTGTTTCAAGTAGTGCTGAACAACACGGCAGTTCAAACAATCAG
GATGAAGCAGCAGATGATGTTCCAGGTGACAACGAAGAAGATGAAGAAGG
TAATGATGGTGAGAATGTTGCTGAAGCAGATGAAGACGAGTCTGACCTTG
ATTTGGCATGGAAAATGCTAGACGTTGCAGGGGCAATTG
back to top