FC920923

Overview
NameFC920923
Unique NameFC920923
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length504
Libraries
Library NameType
RVDevelop1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig7620 contig Ccv1_Contig7620:35..539. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32014H02EF RVDevelop1 Citrus clementina cDNA clone C32014H02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920923 ID=FC920923|Name=FC920923|organism=Citrus clementina|type=EST|length=504bp
CCTCTGTTCGTTCTGTTCTTATTCTTCTTCCCTCTTTTGTTGTTTTGTCA
CTCTTCTTTAGCTTTCGAATCCGACGAGCTTCTCGTCGATGACGAGGAAT
TCGGCCTCGAAGGTGGATCGAAGCCCCAAATTAAGCCCCGTGAACCCGCA
CCCACCCGATCCACGACCACAACGACTCGAAGGAAAGTTTCGGATCAGGA
TTCGGACTCTAAGATCCAATTCTCTTTAGAACACGCTTTTGGTATTCCGA
TTTTGTCCCTGCTGGCACTTTCTCTGCTCGTCTCAAGACTTCGAGCCACG
GTGGCCAGACACTTACAAAGCTGCGTTTTTCAAGAAATGCTTTTACAGGA
GAGGACAAGGAGAAATTTGAAAAGCTACTGCAAGACGATGACTTCTACAG
GATAAGACTGCCATCCAATACTGTGAGCCCTCCTGGTAGGGATTACATTA
TTTCATTCCGTGAAAGCAAGATGTCTTCACGGGAGGGTTTGGATGAGCAT
TTTG
back to top