GH733235

Overview
NameGH733235
Unique NameGH733235
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length486
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Properties
Property NameValue
Genbank descriptionU_12 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733235 ID=GH733235|Name=GH733235|organism=Citrus clementina|type=EST|length=486bp
GACTGCGTACCAATTCACGACTGCGGATGCGGAGCTCAGCTTAGCTCAAA
ACCATTTTCATTGCCTCGATACCTAGATACAAGGGAAAGGAACCGGAACC
AGAAAGATACCTCGGGGGACTTCCCGGGGGGACTGCCCCAAAGACAGGAA
AGGAAAGCACTTGGACCAGTCCTGCCTTTAGGGCAATATGCAATATTATA
TAAACTTCCCTCGTGAGTAATAAGCTAAAGCTTACCTCCTTCCTGCCTAC
AGTGAGCTACGCTGCTAAGAACCCCGTTCGATTTTCACTTGATCCTTGAA
ATTGGATATGGAATATCCAATCCTTGATCTCTTTCTCCTTTACAGGAGGA
AGGCCAATATGGAATATTGATTGGGCGGGCCAGAANAAAGAAATGTTTGA
CTGACGGGACGAGACGAAATAGATCCTCAAGCTTTGNTCACAAACCGTCC
GAGGAATATGGAAATATTACCCTGGAGCCCTGCNCT
back to top