GH733236

Overview
NameGH733236
Unique NameGH733236
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length226
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Properties
Property NameValue
Genbank descriptionU_14 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733236 ID=GH733236|Name=GH733236|organism=Citrus clementina|type=EST|length=226bp
GACTGCGTACCAATTCAGGCGAGAAGTGGCTGAGATCGGCTTTGCCGGAA
GAAGCTGAATTTGGGAAAGGAAACAGTATAACTCCAACTGGTGTAATGAT
GGTGGATTCGGTAGCCAGTCTAAATCCCGGAGATCATGGGCCCAGAACAA
AGGAAAGAAATGTCAGTGCGGGATTTGAGGGATCCGATATAGGAAGGCAG
TAGTATGGTGTTACTCAGGACTCATC
back to top